|
声明:仅到2003末为止,2004以后这样的文章更多,大家可以搜索pubmed。
声明:仅到2003末为止,2004以后这样的文章更多,大家可以搜索pubmed。
|
Gene (Ref) |
Accession # |
Position from ATG |
Gene Target (Comments) |
Cell Line Tested |
| ß-actin (1) |
NM_001101 |
972-994 |
aatgaagatcaagatcattgc |
Human HeLa |
| gamma-actin (1) |
NM_001614 |
8-30 |
aagagatcgccgcgctggtca |
Human HeLa |
| AIB1 (estrogen receptor coactivator) (22) |
|
|
AAAGACUCCUUAGGACCGCUU |
Ishikawa |
| Apaf-1 (31) |
|
978-998 |
AATTGGTGCACTTTTACGTGA |
IMR90E1 |
| ARC21 (1) |
AF006086 |
181-203 |
aagaatgaagctgataggacc |
Human HeLa |
| ATR interacting protein (4) |
AF451323 |
254-274 |
AAGGTCCACAGATTATTAGAT |
Human HeLa |
| ATR interacting protein (4) |
AF451323 |
464-484 |
CTAGAGGAACAGAGAAGATCACA |
Human HeLa |
| ATR interacting protein (4) |
AF451323 |
867-887 |
AAGAAGAGGCCCAGAAAAGCT |
Human HeLa |
| Bcr-abl (32) |
|
|
AAGCAGAGUUCAAAAGCCCUU |
TonB, K562, hematopoetic cells |
| Brc-abl (32) |
|
|
AAAGCAGAGUUCAAAAGCCCU |
TonB, K562, hematopoetic cells |
| beta-tubulin- mouse neuronal (21) |
AF312873 |
|
AAGACAGAGCCAAGUGGACUC |
Mouse P19 |
| Bruton's tyrosine kinase (Btk) (33) |
NM_000061 |
1682-1700 |
AAUUGGUAAACGAUCAAGGAG |
RBL-2H3, WEHI-231, NALM-6 |
| Bruton's tyrosine kinase (Btk) (33) |
NM_000061 |
895-913 |
AAGGGAAAGAAGGAGGUUUCA |
RBL-2H3, WEHI-231, NALM-6 |
| Bruton's tyrosine kinase (Btk) (33) |
NM_000061 |
518-536 |
AAGAAGCUUAAAACCUGGGAG |
RBL-2H3, WEHI-231, NALM-6 |
| Casein Kinase I epsilon and delta (CKI-epsilon and CKI-delta) (17) |
|
520-538 |
AACUGGGGAAGAAGGGCAACC |
HEK293 |
| Caspase 1 (34) |
|
191-211 |
AAGGGGCACAGGCATGCCAAA |
IMR90E1A |
| Caspase 2 (34) |
|
94-114 |
AAACAGCTGTTGTTGAGCGAA |
IMR90E1A |
| hCdc2 (24) |
|
125-147 |
|
HeLa |
| Cdc14A (23) |
|
89-109 |
GCACAGTAAATACCCACTATT |
HeLa |
| cdk1 (1) |
NM_001786 |
125-147 |
aaggggttcctagtactgcaa |
Human HeLa |
| CENP-E (1) |
NM_001813 |
944-966 |
aaactcttactgctctccagt |
Human HeLa |
| CHO1 (20) |
|
138-156 |
AAGGUCAGUAAUACAACGGUG |
CHO |
| corin, mouse (12) |
|
|
AACCACCGCCCUCCGUGCA |
HL-5 and 293 |
| Cyclin B1 (5) |
J03166 |
199-217 |
CTCGTACAGCCTTGGGAGACA |
Xenopus embryo |
| Cyclin B2 (5) |
J03167 |
252-270 |
ATGTTAAGACTAAGCATGTAC |
Xenopus embryo |
| cytoplasmic dynein 1 heavy chain (1) |
U53530 |
509-531 |
aaggccaaggaggcgctggaa |
Human HeLa |
| DIP13-alpha (DCC interacting protein) (25) |
|
|
AAGUGCAGCAACACACCUGAC |
DLD1 |
| DIP13-beta (DCC interacting protein) (25) |
|
|
AAGCAGCACCUCUCCUCCCUU |
DLD1 |
Dishevelled (hDv-1 and hDv-3) (16) |
|
|
AACAAGATCACCTTCTCCGAG |
A293 |
hDv-2 (16) |
|
|
AACTTTGAGAACATGAGCAAC |
A293 |
| Eg5 (1) |
NM_004523 |
1547-1569 |
aactggatcgtaagaaggcag |
Human HeLa |
| emerin (1) |
NM_000117 |
628-650 |
aaccgtgctcctggggctggg |
Human HeLa |
| eve (11) |
|
|
AACUCCUUGAACGGCAGCCGC |
Drosophila embryos |
| hFbw7 (cyclin E ubiquitination) (26) |
|
713-735 |
see reference |
HeLa |
| Fortilin (35) |
|
121-141 |
AAGGUAACAUUGAUGACUCGC |
U2OS |
| GalTII (galactosyltransferase II) (27) |
|
65-87 |
AAGCACGCGACGCUGGCGCGC |
HeLa |
| GalTII (galactosyltransferase II) (27) |
|
461-482 |
AAGGCGGACGACGACUCCUUC |
HeLa |
| GAS41 (1) |
NM_006530 |
327-349 |
aagacctgtaaccctgtatca |
Human HeLa |
| Hec-1 (36) |
NM_006101 |
1517-1539 |
|
HeLa-S3 |
| HPV E6 (38) |
|
|
AAGAGGUAUAUGACUUUGCUU |
CaSKi, SiHa, NDF, HCT116 |
| HPV E7 (38) |
|
|
AAAGGAGGAUGAAAUAGAUGG |
CaSKi, SiHa, NDF, HCT116 |
| HtrA2 (28) |
|
|
AAAACGGCUCAGGAUUCGUGG |
U2OS |
| HtrA2 (28) |
|
|
AAGGGGAGTTTGTTGTTGCCA |
U2OS |
| HtrA2 (28) |
|
|
AAGCTTTCCCGATGTTCAGCA |
|
| keratin 18 (1) |
NM_000224 |
1154-1176 |
aagatggcgaggactttaatc |
Human HeLa |
| Kinase interacting stathmin (hKIS) (39) |
|
160-180 |
AAGCAGTTCTTGCCGCCAGGA |
HEK293 |
| Kinase interacting stathmin (mKIS) (39) |
|
160-180 |
AAGCAGTTCCTGCCTCGGGGA |
HEK293 |
| lamin A (13) |
NM019390 |
260-280 |
GAAGCAGCUUCAGGAUGAGAU |
Human HeLa S3 |
| lamin A (19) |
|
|
AAGGACCUGGAGGUCUGCUG |
Hep3B |
| lamin A/C (1) |
NM_005572 |
608-630 |
aactggacttccagaagaaca (90% reduction; 2) |
Human HeLa |
| lamin B1 (1) |
NM_005573 |
672-694 |
aacgcgcttggtagaggtgga |
Human HeLa |
| lamin B2 (1) |
M94362 |
1457-1479 |
aagaggaggaggaagccgagt |
Human HeLa |
| LAP2 (1) |
NM_003276 |
37-59 |
aaagacaagttgaagagtgag |
Human HeLa |
| Mad1 (41) |
AF083811 |
1843-1865 |
See reference |
HeLa-S3 |
| Mammalian septin (MSF) (44) |
AF189712 |
472-492 |
See reference |
HeLa |
Methyl-CpG-binding protein 2 (MeCP2) (19) |
|
|
AAGCAUGAGCCCGUGCAGCCA |
Hep3B |
| Methyl-CpG binding domain protein 2 (MBD2) (19) |
|
|
AAGAGGAUGGAUUGCCCGGCC |
Hep3B |
| Microtubule-associated protein 2 (MAP2) (42) |
|
|
AAUCCUUCGUCUUUCCUCUCG |
primary neuronal cells |
| Myc-induced nuclear antigen 53 (mina53) (40) |
|
45-63 |
See reference |
HeLa, MycB |
| MPS1 kinase (hMps1) (8) |
|
133-155 |
See reference |
Human HeLa S3 |
| Myeloid cell leukemia protein 1 (MCL1) (43) |
|
456-476 |
AACCCGUCCGUACUGGUGUUA |
U2OS |
| Nicastrin (Nct) (45) |
|
|
AAGGGCAAGTTTCCCGTGCAG |
HEK293 |
| NuMA (1) |
Z11583 |
3988-4010 |
aaggcgtggcaggagaagttc |
Human HeLa |
| Nup153 (1) |
NM_005124 |
2593-2615 |
aaggcagactctaccaaatgt |
Human HeLa |
| Origin recognition complex protein 6 (Orc6) (46) |
|
|
AAUGGUAGCCACAUCCGGUGU |
HeLa |
| Origin recognition complex protein 6 (Orc6) (46) |
|
|
AAGATTGGACAGCAGGUCGAC |
HeLa |
| P160 ROCK (47) |
|
566-584; 639-657; 1958-1976; 2780-2798 |
See reference |
|
| Polo-like Kinase1 (hPlk1) (37) |
NM_005030 |
181-203 |
AAGGGCGGCTTTGCCAAGTGC |
HeLa, U2OS |
| Protein Kinase Receptor (PKR) (9) |
|
931-949 |
AAGATCAAGTTTTGCCAATG |
Human HeLa |
| hRad9 (29) |
U53174 |
232-252 |
AAGUCUUUCCUGUCUGUCUUU |
MCF-7 |
| Rad17 (7) |
|
|
AACAGACUGGGUUGACCCAUC |
Human HeLa |
| Signalling Adapter/scaffold protein (h/m Shc) (3) |
HSU73377 |
677-697 |
tcctacttggttcggtacatggg |
Human HeLa |
| p66 ShcA (3) |
HSU73377 |
236-256 |
CGGAATGAGTCTCTGTCATCGTC |
Human HeLa |
Sphingosine kinase 1 (hSK1) (15) |
|
70 nt downstream of start codon |
AAGAGCUGCAAGGCCUUGCCC |
HUVEC |
| Steroid receptor coactivator (SRC-1) (30) |
|
|
CCUCAGGGCAGAGAACCAUCUTT |
Ishikawa |
| ß-tubulin (6) |
AF312873 |
3'-UTR |
GACAGAGCCAAGUGGACUCAC |
Mouse P19 |
| Tissue Factor (hTF) (18) |
M16553 |
|
AAGCGCUUCAGGCACUACAAA |
HeLa, 293, Cos-1, HaCaT |
| Tissue Factor (hTF) (18) |
M16553 |
|
AAGAAGCAGACGUACUUGGCA |
HeLa, 293, Cos-1, HaCaT |
| ß-transducin repeat-containing protein (ß-TrCP), human (10) |
|
|
GUGGAAUUUGUGGAACAUCTT |
293 |
| TSG101 (a ubiquitin enzyme 2 variant protein) (14) |
|
413-433 |
AACCUCCAGUCUUCUCUCGUC |
Human HeLa-M & HeLa KK3 |
| VASP (1) |
XM_009141 |
1087-1109 |
aaagaggaaatcattgaagcc |
Human HeLa |
| vimentin (1) |
NM_003380 |
346-368 |
aactacatcgacaaggtgcgc (No silencing observed; 1,2) |
Human HeLa |
| vimentin (1) |
NM_003380 |
1145-1167 |
aataccaagacctgctcaatg |
Human HeLa |
| vimentin (1) |
NM_003380 |
863-885 |
aagaatggtacaaatccaagt |
Human HeLa |
| vimentin (1) |
NM_003380 |
1037-1059 |
aaatggaagagaactttgccg |
Human HeLa |
| vinculin, mouse (1) |
L18880 |
2923-2945 |
aagcggattagaaccaatctc |
Mouse 3T3 |
| zyxin, mouse (1) |
X99063 |
1357-1379 |
aaagcctaccacccacagtgc |
Mouse 3T3 |
参考文献
- Harborth J, Elbashir SM, Bechert K, Tuschl T, and Weber K. (2001) Identification of essential genes in cultured mammalian cells using small interfering RNAs. J Cell Science 114: 4557-4565.
- Elbashir SM, Harborth J, Lendeckel W, Yalcin A, Weber K, and Tuschl T. (2001) Duplexes of 21-nucleotide RNAs mediate RNA interference in cultured mammalian cells. Nature 411: 494-498.
- Kisielow M, Kleiner S, Nagasawa M, Faisal A, and Nagamine Y. (2002) Isoform-specific knockdown and expression of adapter protein ShcA using small interfering RNA. Biochem. J. 363:1-5.
- Cortez D, Guntuku S, Qin J, and Elledge SJ. (2001) ATR and ATRIP: partners in checkpoint signaling. Science 294:1713-1716.
- Zhou Y, Ching Y-P, Kok KH, Kung H-F, Jin D-Y. (2002). Post-transcriptional suppression of gene expression in Xenopus embryos by small interfering RNA. Nucleic Acids Res 30(7):1664-1669.
- Yu J-Y, DeRuiter SL, Turner DL. (2002). RNA interference by expression of short-interfering RNAs and hairpin RNAs in mammalian cells. Proc. Natl. Acad. Sci. USA 99(9):6047-6052.
- Zou L, Cortez D, and Elledge SJ. (2002). Regulation of ATR substrate selection by Rad17-dependent loading of Rad9 complexes onto chromatin. Genes & Devel. 16:198-208.
- Stucke VM, Sillje HHW, Arnaud L, and Nigg EA. (2002). Human Mps1 kinase is required for the spindle assembly checkpoint but not for centrosome duplication. EMBO 21(7):1723-1732.
- Donze O, and Picard D. (2002). RNA interference in mammalian cells using siRNAs synthesized with T7 polymerase. Nucl. Acids Res. 30(10): e46.
- Fong A, and Sun S-C. (May 6, 2002). Genetic evidence for the essential role of beta-transducin repeat-containing protein in the inducible processing of NF-kB2/p100. J. Biol. Chem. (preprint).
- Williams R, and Rubin GM. (2002). ARGONAUTE1 is required for efficient RNA interference in Drosophila embryos. Proc. Natl. Acad. Sci. USA 99(10):6889-6894.
- Wu F, Yan W, Pan J, Morser J, and Wu Q. (2002). Processing of pro-atrial natriuretic peptide by corin in cardiac myocytes. J. Biol. Chem. 277(19):16900-16905.
- Bai, X, Zhou, D, Brown, JR, Crawford, BE, Hennet, T, and Esko, JD. (2001). Biosynthesis of the linkage region of glycosaminoglycans. J. Biol. Chem. 276(51):48189-48195.
- Hewitt EW, Duncan L, Mufti D, Baker J, Stevenson PG, and Lehner PJ. (2002). Ubiquitylation of MHC class I by the K3 viral protein signals internalization and TSG101-dependent degradation. EMBO 21(10): 2418-2429.
- Ancellin, N, Colmont, C, Su, J, Li, Q, Mittereder, N, Chae, S-S, Stefansson, S, Liau, G, and Hla, T. (2002). Extracelllular export of sphingosine kinase-1 enzyme. J. Biol. Chem. 277(8):6667-6675.
- Li L, Mao J, Sun L, Liu W, and Wu D. (2002). Second cysteine-rich domain of Dickkopf-2 activates canonical Wnt signaling pathway via LRP-6 independently of Dishevelled. J. Biol. Chem. 277(8):5977-5981.
- Eide EJ, Bielhaber EL, Hinz W, and Virshup DM. (2002). The circadian regulatory proteins BMAL1 and Cryptochromes are substrates of casein kinase I epsilon. J. Biol. Chem. 277(19):17248-17254.
- Holen T, Amarzguioui M, Wiige, MT, Babaie E, and Prydz H. (2002). Positional effects of short interfering RNAs targeting the human coagulation trigger tissue factor. Nucl. Acids Res. 30(8):1757-1766.
- Bakker J, Lin X, and Nelson WG. (2002). Methyl-CpG binding domain protein 2 represses transcription from hypermethylated p-class glutathione-S-transferase gene promoters in hepatocellular carcinoma cells. J. Biol. Chem. (in press).
- Matuliene J, and Kuriyama R. (17 April 2002). Kinesin-like protein CHO1 is required for the formation of midbody matrix and the completion of cytokinesis in mammalian cells. Mol. Biol. Cell. (in press).
- Yu, J-Y, DeRuiter, SL, Turner, DL. (2002). RNA interference by expression of short-interfering RNAs and hairpin RNAs in mammalian cells. Proc. Natl. Acad. Sci. USA 99(9):6047-6052.
- Shang Y and Brown M. (2002). Molecular determinants for the tissue specificity of SERMs. Science 295:2465-2468.
- Mailand N, Lukas C, Kaiser BK, Jackson PK, Bartek J, and Lukas J. (2002). Deregulated human Cdc14A phosphatase disrupts centrosome separation and chromosome segregation. Nature Cell Biol. 4:317-322.
- Chang T-S, Jeong W, Choi SY, Yu S, Kang SW, and Rhee SG. (2002). Regulation of peroxiredoxin I activity by Cdc2-mediated phosphorylation. J. Biol. Chem. 277(28):25370-25376.
- Liu J, Yao F, Wu R, Morgan M, Thorburn A, Finely RL, Chen YQ. (2002). Mediation of the DCC apoptotic signal by DIP13 alpha. J. Biol. Chem. 277(29):26281-26285.
- Koepp DM, Schaefer LK, Ye X, Keyomarsi K, Chu C, Harper JW, and Elledge SJ. (2001). Phosphorylation-dependent ubiquitination of cyclin E by the SCF-Fbw7 ubiquitin ligase. Science 294(5540):173-177.
- Bai, X, Zhou, D, Brown, JR, Crawford, BE, Hennet, T, and Esko, JD. (2001). Biosynthesis of the linkage region of glycosaminoglycans. J. Biol. Chem. 276(51):48189-48195.
- Martins et al. (2002). The serine protease Omi/HtrA2 regulates apoptosis by binding XIAP through a reaper like motif. J. Biol. Chem. 277:439-444.
- Hirai H and Wang H-G. (2002). A role of the C-terminal region of human Rad9 (hRad9) in nuclear transport of the hRad9 checkpoint complex. J. Biol. Chem. 277(28):25722-25727.
- Shang Y and Brown M. (2002). Molecular determinants for the tissue specificity of SERMs. Science 295:2465-2468.
- Lassus P, Opitz-Araya X, and Lazebnik Y. (2002). Requirement for caspase-2 in stress-induced apoptosis before mitochondrial permeabilization. Science 297:1352-1354.
- Scherr M, Battmer K, Winkler T, Heidenreich O, Ganser A, and Eder M. (2002). Specific inhibition of bcr-abl gene expression by small interfering RNA. Blood (online September 26, 2002 issue)
- Heinonen JE, Smith CIE, and Nore BF. (2002). Silencing of Bruton's tyrosine kinase (Btk) using short interfering RNA duplexes (siRNA). FEBS Lett 527:274-278.
- Lassus P, Opitz-Araya X, and Lazebnik Y. (2002). Requirement for caspase-2 in stress-induced apoptosis before mitochondrial permeabilization. Science 297:1352-1354.
- Zhang D, Li F, Weidner D, Mnjoyan ZH, and Fujise K. (2002). Physical and functional interaction between myeloid cell leukemia 1 protein (MCL1) and fortilin. J. Biol. Chem. 277(40):37430-37438.
- Martin-Lluesma S, Stucke VM, and Nigg EA. (2002). Role of Hec1 in spindle checkpoint signaling and kinetochore recruitment of Mad1/Mad2. Science 297:2267-2270.
- Liu X and Erikson RL. (2002). Activation of Cdc2/cyclin B and inhibition of centromere amplification in cells depleted of Plk1 by siRNA. Proc. Natl. Acad. Sci. USA 99(13):8672-8676.
- Jiang M and Milner J. (2002). Selective silencing of viral gene expression in HPV-positive human cervical carcinoma cells treated with siRNA, a primer of RNA interference. Oncogene 21:6041-6048.
- Boehm M, Yoshimoto T, Crook MF, Nallamshetty S, True A, Nabel G, and Nabel EG. (2002). A growth factor-dependent nuclear kinase phosphorylates p27kip1 and regulates cell cycle progression. EMBO J. 21(13):3390-3401.
- Tsuneoka M, Koda Y, Soejima M, Teye K, and Kimura H. (2002). A novel Myc target gene, mina53, that is involved in cell proliferation. J. Biol. Chem. 277(38):35450-35459.
- Martin-Lluesma S, Stucke VM, and Nigg EA. (2002). Role of Hec1 in spindle checkpoint signaling and kinetochore recruitment of Mad1/Mad2. Science 297:2267-2270.
- Krichevsky AM and Kosik KS. (2002). RNAi functions in cultured mammalian neurons. Proc. Natl. Acad. Sci USA 99(18):11926-11929.
- Zhang D, Li F, Weidner D, Mnjoyan ZH, and Fujise K. (2002). Physical and functional interaction between myeloid cell leukemia 1 protein (MCL1) and fortilin. J. Biol. Chem. 277(40):37430-37438.
- Surka MC, Tsang CW, and Trimble WS. (2002). The mammalian septin MSF localizes with microtubules and is required for completion of cytokinesis. Mol Biol. Cell 13:3532-3545.
- Edbauer D, Winkler E, Haass C, and Steiner H. (2002). Presenilin and nicastrin regulate each other and determine amyloid b-peptide production via complex formation. Proc. Natl. Acad. Sci. USA 99(13):8666-8671.
- Prasanth SG, Prasanth KV, and Stillman B. (2002). Orc6 involved in DNA replication, chromosome segregation, and cytokinesis. Science 297:1026-1031.
- Chevrier V, Piel M, Collomb N, Saoudi Y, Frank R, Paintrand M, Narumiya S, Bornens M, and Job D. (2002). The Rho-associated protein kinase p160ROCK is required for centrosome positioning. J. Cell Biol. 157:807-817.
上一篇:果蝇RNAi的实验中双链短RNA的合成(dsRNA)方法 下一篇:Affinity Chromatography
|