声明：仅到2003末为止，2004以后这样的文章更多，大家可以搜索pubmed。

声明：仅到2003末为止，2004以后这样的文章更多，大家可以搜索pubmed。

Gene (Ref)	Accession #	Position from ATG	Gene Target (Comments)	Cell Line Tested
ß-actin (1)	NM_001101	972-994	aatgaagatcaagatcattgc	Human HeLa
gamma-actin (1)	NM_001614	8-30	aagagatcgccgcgctggtca	Human HeLa
AIB1 (estrogen receptor coactivator) (22)			AAAGACUCCUUAGGACCGCUU	Ishikawa
Apaf-1 (31)		978-998	AATTGGTGCACTTTTACGTGA	IMR90E1
ARC21 (1)	AF006086	181-203	aagaatgaagctgataggacc	Human HeLa
ATR interacting protein (4)	AF451323	254-274	AAGGTCCACAGATTATTAGAT	Human HeLa
ATR interacting protein (4)	AF451323	464-484	CTAGAGGAACAGAGAAGATCACA	Human HeLa
ATR interacting protein (4)	AF451323	867-887	AAGAAGAGGCCCAGAAAAGCT	Human HeLa
Bcr-abl (32)			AAGCAGAGUUCAAAAGCCCUU	TonB, K562, hematopoetic cells
Brc-abl (32)			AAAGCAGAGUUCAAAAGCCCU	TonB, K562, hematopoetic cells
beta-tubulin- mouse neuronal (21)	AF312873		AAGACAGAGCCAAGUGGACUC	Mouse P19
Bruton's tyrosine kinase (Btk) (33)	NM_000061	1682-1700	AAUUGGUAAACGAUCAAGGAG	RBL-2H3, WEHI-231, NALM-6
Bruton's tyrosine kinase (Btk) (33)	NM_000061	895-913	AAGGGAAAGAAGGAGGUUUCA	RBL-2H3, WEHI-231, NALM-6
Bruton's tyrosine kinase (Btk) (33)	NM_000061	518-536	AAGAAGCUUAAAACCUGGGAG	RBL-2H3, WEHI-231, NALM-6
Casein Kinase I epsilon and delta (CKI-epsilon and CKI-delta) (17)		520-538	AACUGGGGAAGAAGGGCAACC	HEK293
Caspase 1 (34)		191-211	AAGGGGCACAGGCATGCCAAA	IMR90E1A
Caspase 2 (34)		94-114	AAACAGCTGTTGTTGAGCGAA	IMR90E1A
hCdc2 (24)		125-147		HeLa
Cdc14A (23)		89-109	GCACAGTAAATACCCACTATT	HeLa
cdk1 (1)	NM_001786	125-147	aaggggttcctagtactgcaa	Human HeLa
CENP-E (1)	NM_001813	944-966	aaactcttactgctctccagt	Human HeLa
CHO1 (20)		138-156	AAGGUCAGUAAUACAACGGUG	CHO
corin, mouse (12)			AACCACCGCCCUCCGUGCA	HL-5 and 293
Cyclin B1 (5)	J03166	199-217	CTCGTACAGCCTTGGGAGACA	Xenopus embryo
Cyclin B2 (5)	J03167	252-270	ATGTTAAGACTAAGCATGTAC	Xenopus embryo
cytoplasmic dynein 1 heavy chain (1)	U53530	509-531	aaggccaaggaggcgctggaa	Human HeLa
DIP13-alpha (DCC interacting protein) (25)			AAGUGCAGCAACACACCUGAC	DLD1
DIP13-beta (DCC interacting protein) (25)			AAGCAGCACCUCUCCUCCCUU	DLD1
Dishevelled (hDv-1 and hDv-3) (16)			AACAAGATCACCTTCTCCGAG	A293
hDv-2 (16)			AACTTTGAGAACATGAGCAAC	A293
Eg5 (1)	NM_004523	1547-1569	aactggatcgtaagaaggcag	Human HeLa
emerin (1)	NM_000117	628-650	aaccgtgctcctggggctggg	Human HeLa
eve (11)			AACUCCUUGAACGGCAGCCGC	Drosophila embryos
hFbw7 (cyclin E ubiquitination) (26)		713-735	see reference	HeLa
Fortilin (35)		121-141	AAGGUAACAUUGAUGACUCGC	U2OS
GalTII (galactosyltransferase II) (27)		65-87	AAGCACGCGACGCUGGCGCGC	HeLa
GalTII (galactosyltransferase II) (27)		461-482	AAGGCGGACGACGACUCCUUC	HeLa
GAS41 (1)	NM_006530	327-349	aagacctgtaaccctgtatca	Human HeLa
Hec-1 (36)	NM_006101	1517-1539		HeLa-S3
HPV E6 (38)			AAGAGGUAUAUGACUUUGCUU	CaSKi, SiHa, NDF, HCT116
HPV E7 (38)			AAAGGAGGAUGAAAUAGAUGG	CaSKi, SiHa, NDF, HCT116
HtrA2 (28)			AAAACGGCUCAGGAUUCGUGG	U2OS
HtrA2 (28)			AAGGGGAGTTTGTTGTTGCCA	U2OS
HtrA2 (28)			AAGCTTTCCCGATGTTCAGCA
keratin 18 (1)	NM_000224	1154-1176	aagatggcgaggactttaatc	Human HeLa
Kinase interacting stathmin (hKIS) (39)		160-180	AAGCAGTTCTTGCCGCCAGGA	HEK293
Kinase interacting stathmin (mKIS) (39)		160-180	AAGCAGTTCCTGCCTCGGGGA	HEK293
lamin A (13)	NM019390	260-280	GAAGCAGCUUCAGGAUGAGAU	Human HeLa S3
lamin A (19)			AAGGACCUGGAGGUCUGCUG	Hep3B
lamin A/C (1)	NM_005572	608-630	aactggacttccagaagaaca (90% reduction; 2)	Human HeLa
lamin B1 (1)	NM_005573	672-694	aacgcgcttggtagaggtgga	Human HeLa
lamin B2 (1)	M94362	1457-1479	aagaggaggaggaagccgagt	Human HeLa
LAP2 (1)	NM_003276	37-59	aaagacaagttgaagagtgag	Human HeLa
Mad1 (41)	AF083811	1843-1865	See reference	HeLa-S3
Mammalian septin (MSF) (44)	AF189712	472-492	See reference	HeLa
Methyl-CpG-binding protein 2 (MeCP2) (19)			AAGCAUGAGCCCGUGCAGCCA	Hep3B
Methyl-CpG binding domain protein 2 (MBD2) (19)			AAGAGGAUGGAUUGCCCGGCC	Hep3B
Microtubule-associated protein 2 (MAP2) (42)			AAUCCUUCGUCUUUCCUCUCG	primary neuronal cells
Myc-induced nuclear antigen 53 (mina53) (40)		45-63	See reference	HeLa, MycB
MPS1 kinase (hMps1) (8)		133-155	See reference	Human HeLa S3
Myeloid cell leukemia protein 1 (MCL1) (43)		456-476	AACCCGUCCGUACUGGUGUUA	U2OS
Nicastrin (Nct) (45)			AAGGGCAAGTTTCCCGTGCAG	HEK293
NuMA (1)	Z11583	3988-4010	aaggcgtggcaggagaagttc	Human HeLa
Nup153 (1)	NM_005124	2593-2615	aaggcagactctaccaaatgt	Human HeLa
Origin recognition complex protein 6 (Orc6) (46)			AAUGGUAGCCACAUCCGGUGU	HeLa
Origin recognition complex protein 6 (Orc6) (46)			AAGATTGGACAGCAGGUCGAC	HeLa
P160 ROCK (47)		566-584; 639-657; 1958-1976; 2780-2798	See reference
Polo-like Kinase1 (hPlk1) (37)	NM_005030	181-203	AAGGGCGGCTTTGCCAAGTGC	HeLa, U2OS
Protein Kinase Receptor (PKR) (9)		931-949	AAGATCAAGTTTTGCCAATG	Human HeLa
hRad9 (29)	U53174	232-252	AAGUCUUUCCUGUCUGUCUUU	MCF-7
Rad17 (7)			AACAGACUGGGUUGACCCAUC	Human HeLa
Signalling Adapter/scaffold protein (h/m Shc) (3)	HSU73377	677-697	tcctacttggttcggtacatggg	Human HeLa
p66 ShcA (3)	HSU73377	236-256	CGGAATGAGTCTCTGTCATCGTC	Human HeLa
Sphingosine kinase 1 (hSK1) (15)		70 nt downstream of start codon	AAGAGCUGCAAGGCCUUGCCC	HUVEC
Steroid receptor coactivator (SRC-1) (30)			CCUCAGGGCAGAGAACCAUCUTT	Ishikawa
ß-tubulin (6)	AF312873	3'-UTR	GACAGAGCCAAGUGGACUCAC	Mouse P19
Tissue Factor (hTF) (18)	M16553		AAGCGCUUCAGGCACUACAAA	HeLa, 293, Cos-1, HaCaT
Tissue Factor (hTF) (18)	M16553		AAGAAGCAGACGUACUUGGCA	HeLa, 293, Cos-1, HaCaT
ß-transducin repeat-containing protein (ß-TrCP), human (10)			GUGGAAUUUGUGGAACAUCTT	293
TSG101 (a ubiquitin enzyme 2 variant protein) (14)		413-433	AACCUCCAGUCUUCUCUCGUC	Human HeLa-M & HeLa KK3
VASP (1)	XM_009141	1087-1109	aaagaggaaatcattgaagcc	Human HeLa
vimentin (1)	NM_003380	346-368	aactacatcgacaaggtgcgc (No silencing observed; 1,2)	Human HeLa
vimentin (1)	NM_003380	1145-1167	aataccaagacctgctcaatg	Human HeLa
vimentin (1)	NM_003380	863-885	aagaatggtacaaatccaagt	Human HeLa
vimentin (1)	NM_003380	1037-1059	aaatggaagagaactttgccg	Human HeLa
vinculin, mouse (1)	L18880	2923-2945	aagcggattagaaccaatctc	Mouse 3T3
zyxin, mouse (1)	X99063	1357-1379	aaagcctaccacccacagtgc	Mouse 3T3

 

参考文献

1. Harborth J, Elbashir SM, Bechert K, Tuschl T, and Weber K. (2001) Identification of essential genes in cultured mammalian cells using small interfering RNAs. J Cell Science 114: 4557-4565.
   
   
2. Elbashir SM, Harborth J, Lendeckel W, Yalcin A, Weber K, and Tuschl T. (2001) Duplexes of 21-nucleotide RNAs mediate RNA interference in cultured mammalian cells. Nature 411: 494-498.
   
   
3. Kisielow M, Kleiner S, Nagasawa M, Faisal A, and Nagamine Y. (2002) Isoform-specific knockdown and expression of adapter protein ShcA using small interfering RNA. Biochem. J. 363:1-5.
   
   
4. Cortez D, Guntuku S, Qin J, and Elledge SJ. (2001) ATR and ATRIP: partners in checkpoint signaling. Science 294:1713-1716.
   
   
5. Zhou Y, Ching Y-P, Kok KH, Kung H-F, Jin D-Y. (2002). Post-transcriptional suppression of gene expression in Xenopus embryos by small interfering RNA. Nucleic Acids Res 30(7):1664-1669.
   
   
6. Yu J-Y, DeRuiter SL, Turner DL. (2002). RNA interference by expression of short-interfering RNAs and hairpin RNAs in mammalian cells. Proc. Natl. Acad. Sci. USA 99(9):6047-6052.
   
   
7. Zou L, Cortez D, and Elledge SJ. (2002). Regulation of ATR substrate selection by Rad17-dependent loading of Rad9 complexes onto chromatin. Genes & Devel. 16:198-208.
   
   
8. Stucke VM, Sillje HHW, Arnaud L, and Nigg EA. (2002). Human Mps1 kinase is required for the spindle assembly checkpoint but not for centrosome duplication. EMBO 21(7):1723-1732.
   
   
9. Donze O, and Picard D. (2002). RNA interference in mammalian cells using siRNAs synthesized with T7 polymerase. Nucl. Acids Res. 30(10): e46.
   
   
10. Fong A, and Sun S-C. (May 6, 2002). Genetic evidence for the essential role of beta-transducin repeat-containing protein in the inducible processing of NF-kB2/p100. J. Biol. Chem. (preprint).
    
    
11. Williams R, and Rubin GM. (2002). ARGONAUTE1 is required for efficient RNA interference in Drosophila embryos. Proc. Natl. Acad. Sci. USA 99(10):6889-6894.
    
    
12. Wu F, Yan W, Pan J, Morser J, and Wu Q. (2002). Processing of pro-atrial natriuretic peptide by corin in cardiac myocytes. J. Biol. Chem. 277(19):16900-16905.
    
    
13. Bai, X, Zhou, D, Brown, JR, Crawford, BE, Hennet, T, and Esko, JD. (2001). Biosynthesis of the linkage region of glycosaminoglycans. J. Biol. Chem. 276(51):48189-48195.
    
    
14. Hewitt EW, Duncan L, Mufti D, Baker J, Stevenson PG, and Lehner PJ. (2002). Ubiquitylation of MHC class I by the K3 viral protein signals internalization and TSG101-dependent degradation. EMBO 21(10): 2418-2429.
    
    
15. Ancellin, N, Colmont, C, Su, J, Li, Q, Mittereder, N, Chae, S-S, Stefansson, S, Liau, G, and Hla, T. (2002). Extracelllular export of sphingosine kinase-1 enzyme. J. Biol. Chem. 277(8):6667-6675.
    
    
16. Li L, Mao J, Sun L, Liu W, and Wu D. (2002). Second cysteine-rich domain of Dickkopf-2 activates canonical Wnt signaling pathway via LRP-6 independently of Dishevelled. J. Biol. Chem. 277(8):5977-5981.
    
    
17. Eide EJ, Bielhaber EL, Hinz W, and Virshup DM. (2002). The circadian regulatory proteins BMAL1 and Cryptochromes are substrates of casein kinase I epsilon. J. Biol. Chem. 277(19):17248-17254.
    
    
18. Holen T, Amarzguioui M, Wiige, MT, Babaie E, and Prydz H. (2002). Positional effects of short interfering RNAs targeting the human coagulation trigger tissue factor. Nucl. Acids Res. 30(8):1757-1766.
    
    
19. Bakker J, Lin X, and Nelson WG. (2002). Methyl-CpG binding domain protein 2 represses transcription from hypermethylated p-class glutathione-S-transferase gene promoters in hepatocellular carcinoma cells. J. Biol. Chem. (in press).
    
    
20. Matuliene J, and Kuriyama R. (17 April 2002). Kinesin-like protein CHO1 is required for the formation of midbody matrix and the completion of cytokinesis in mammalian cells. Mol. Biol. Cell. (in press).
    
    
21. Yu, J-Y, DeRuiter, SL, Turner, DL. (2002). RNA interference by expression of short-interfering RNAs and hairpin RNAs in mammalian cells. Proc. Natl. Acad. Sci. USA 99(9):6047-6052.
    
    
22. Shang Y and Brown M. (2002). Molecular determinants for the tissue specificity of SERMs. Science 295:2465-2468.
    
    
23. Mailand N, Lukas C, Kaiser BK, Jackson PK, Bartek J, and Lukas J. (2002). Deregulated human Cdc14A phosphatase disrupts centrosome separation and chromosome segregation. Nature Cell Biol. 4:317-322.
    
    
24. Chang T-S, Jeong W, Choi SY, Yu S, Kang SW, and Rhee SG. (2002). Regulation of peroxiredoxin I activity by Cdc2-mediated phosphorylation. J. Biol. Chem. 277(28):25370-25376.
    
    
25. Liu J, Yao F, Wu R, Morgan M, Thorburn A, Finely RL, Chen YQ. (2002). Mediation of the DCC apoptotic signal by DIP13 alpha. J. Biol. Chem. 277(29):26281-26285.
    
    
26. Koepp DM, Schaefer LK, Ye X, Keyomarsi K, Chu C, Harper JW, and Elledge SJ. (2001). Phosphorylation-dependent ubiquitination of cyclin E by the SCF-Fbw7 ubiquitin ligase. Science 294(5540):173-177.
    
    
27. Bai, X, Zhou, D, Brown, JR, Crawford, BE, Hennet, T, and Esko, JD. (2001). Biosynthesis of the linkage region of glycosaminoglycans. J. Biol. Chem. 276(51):48189-48195.
    
    
28. Martins et al. (2002). The serine protease Omi/HtrA2 regulates apoptosis by binding XIAP through a reaper like motif. J. Biol. Chem. 277:439-444.
    
    
29. Hirai H and Wang H-G. (2002). A role of the C-terminal region of human Rad9 (hRad9) in nuclear transport of the hRad9 checkpoint complex. J. Biol. Chem. 277(28):25722-25727.
    
    
30. Shang Y and Brown M. (2002). Molecular determinants for the tissue specificity of SERMs. Science 295:2465-2468.
    
    
31. Lassus P, Opitz-Araya X, and Lazebnik Y. (2002). Requirement for caspase-2 in stress-induced apoptosis before mitochondrial permeabilization. Science 297:1352-1354.
    
    
32. Scherr M, Battmer K, Winkler T, Heidenreich O, Ganser A, and Eder M. (2002). Specific inhibition of bcr-abl gene expression by small interfering RNA. Blood (online September 26, 2002 issue)
    
    
33. Heinonen JE, Smith CIE, and Nore BF. (2002). Silencing of Bruton's tyrosine kinase (Btk) using short interfering RNA duplexes (siRNA). FEBS Lett 527:274-278.
    
    
34. Lassus P, Opitz-Araya X, and Lazebnik Y. (2002). Requirement for caspase-2 in stress-induced apoptosis before mitochondrial permeabilization. Science 297:1352-1354.
    
    
35. Zhang D, Li F, Weidner D, Mnjoyan ZH, and Fujise K. (2002). Physical and functional interaction between myeloid cell leukemia 1 protein (MCL1) and fortilin. J. Biol. Chem. 277(40):37430-37438.
    
    
36. Martin-Lluesma S, Stucke VM, and Nigg EA. (2002). Role of Hec1 in spindle checkpoint signaling and kinetochore recruitment of Mad1/Mad2. Science 297:2267-2270.
    
    
37. Liu X and Erikson RL. (2002). Activation of Cdc2/cyclin B and inhibition of centromere amplification in cells depleted of Plk1 by siRNA. Proc. Natl. Acad. Sci. USA 99(13):8672-8676.
    
    
38. Jiang M and Milner J. (2002). Selective silencing of viral gene expression in HPV-positive human cervical carcinoma cells treated with siRNA, a primer of RNA interference. Oncogene 21:6041-6048.
    
    
39. Boehm M, Yoshimoto T, Crook MF, Nallamshetty S, True A, Nabel G, and Nabel EG. (2002). A growth factor-dependent nuclear kinase phosphorylates p27kip1 and regulates cell cycle progression. EMBO J. 21(13):3390-3401.
    
    
40. Tsuneoka M, Koda Y, Soejima M, Teye K, and Kimura H. (2002). A novel Myc target gene, mina53, that is involved in cell proliferation. J. Biol. Chem. 277(38):35450-35459.
    
    
41. Martin-Lluesma S, Stucke VM, and Nigg EA. (2002). Role of Hec1 in spindle checkpoint signaling and kinetochore recruitment of Mad1/Mad2. Science 297:2267-2270.
    
    
42. Krichevsky AM and Kosik KS. (2002). RNAi functions in cultured mammalian neurons. Proc. Natl. Acad. Sci USA 99(18):11926-11929.
    
    
43. Zhang D, Li F, Weidner D, Mnjoyan ZH, and Fujise K. (2002). Physical and functional interaction between myeloid cell leukemia 1 protein (MCL1) and fortilin. J. Biol. Chem. 277(40):37430-37438.
    
    
44. Surka MC, Tsang CW, and Trimble WS. (2002). The mammalian septin MSF localizes with microtubules and is required for completion of cytokinesis. Mol Biol. Cell 13:3532-3545.
    
    
45. Edbauer D, Winkler E, Haass C, and Steiner H. (2002). Presenilin and nicastrin regulate each other and determine amyloid b-peptide production via complex formation. Proc. Natl. Acad. Sci. USA 99(13):8666-8671.
    
    
46. Prasanth SG, Prasanth KV, and Stillman B. (2002). Orc6 involved in DNA replication, chromosome segregation, and cytokinesis. Science 297:1026-1031.
    
    
47. Chevrier V, Piel M, Collomb N, Saoudi Y, Frank R, Paintrand M, Narumiya S, Bornens M, and Job D. (2002). The Rho-associated protein kinase p160ROCK is required for centrosome positioning. J. Cell Biol. 157:807-817.